Volume 16, Issue 1 (Jan-Feb 2022)                   mljgoums 2022, 16(1): 40-47 | Back to browse issues page


XML Print


Download citation:
BibTeX | RIS | EndNote | Medlars | ProCite | Reference Manager | RefWorks
Send citation to:

zanghaneh F, farzanegi P, asgharpour H. Effect of Exercise Training and Atorvastatin Supplementation on Beclin1, LC3-I and LC3-П Expression in Old Diabetic Rats. mljgoums 2022; 16 (1) :40-47
URL: http://mlj.goums.ac.ir/article-1-1275-en.html
1- Department of Exercise Physiology, Aliabad Katul Branch, Islamic Azad University, Aliabad Katul, Iran
2- Department of Exercise Physiology, Sari Branch, Islamic Azad University, Sari, Iran , parvin.farzanegi@gmail.com
Full-Text [PDF 966 kb]   (2126 Downloads)     |   Abstract (HTML)  (8550 Views)
Full-Text:   (1806 Views)
ABSTRACT
Background and objectives: Programmed autophagy is a genetically and evolutionarily conserved process that destroys long-lived cellular proteins and organelles. This study aimed to investigate effects of continuous and interval exercise training with or without atorvastatin supplementation on Beclin1, LC3-I and LC3-П expression in old rats with type 2 diabetes.
Methods: Sixty three male Wistar rats were divided into eight groups. Continuous exercise was performed at a speed of 15-29 m/min for 5-22 minutes. Interval exercise program consisted of six 2.5-minute sets that included a four-minute rest period between each set. The rats in the supplementation groups also received 20 mg/kg body weight atorvastatin daily via intraperitoneal injection. At the end of the training period, the expression of Beclin1, LC3-I and LC3-П in soleus muscle was measured by RT-PCR. One-way ANOVA was used for data analysis at statistical significance of 0.05.
Results: The results showed that both exercise trainings with or without atorvastatin significantly reduced LC3I, LC3-II and Beclin1 compared with the diabetic control group (P<0.05). In addition, the effects of the trainings and atorvastatin supplement did not differ significantly (P>0.05).
Conclusion: The results indicate that continuous and interval exercise program alone and combined with atorvastatin supplementation could significantly reduce LC3-1, LC3-II and Beclin1 level in soleus muscle of old diabetic rats.
Keywords: Interval Exercise, Autophagy, Type 2 Diabetes, Atorvastatin
 
 
INTRODUCTION
Aging is associated with biological changes in an organism, leading to a decrease
in vital and adaptive energy (1). From the age of 30 to 60 years, muscle mass decreases by about 1% per year, and this procedure is accelerated after 60 years. Decreased muscle mass can increase the risk of metabolic diseases, such as type 2 diabetes, metabolic syndrome and cardiovascular disease as well as chronic diseases of the musculoskeletal structure and cancer (2). It is estimated that the world’s older population will be doubled to 1.2 billion by 2025. In addition, the prevalence of type 2 diabetes increases with age and reaches its maximum by the age of 60-74 years (3). Diabetes mellitus is the most common endocrine disorder among the elderly (4). It is estimated that the worldwide prevalence of diabetes will increase to 366 million by 2030 (5). Type 2 diabetes mellitus is the biggest health challenge of the 21st century (6). Skeletal muscle mass changes with the decrease in the total cross-sectional area. The proteolysis of skeletal muscle is mostly regulated via intracellular proteolytic complex systems, including the lysosomal system, activated Ca2+ system, cytosol and ATP-ubiquitin-dependent proteolysis (7). Diabetes reduces muscle volume and skeletal muscle mass, which consequently decrease basal metabolic rate during aging. In addition, changes in the endocrine glands, such as elevated insulin level, may lead to insulin resistance in the long run. In fact, the loss of skeletal muscle mass or muscle atrophy is due to the complex interaction of cell apoptosis, the increased production of free radicals and the activity of proteolytic systems (8).
There are several systems for the destruction of muscle proteins, the most important of which are the ubiquitin-proteasome system and the autophagy-lysosome system (9). Beclin-1 is involved in most biological processes, including stress adaptation, growth, endocytosis, immunity and aging (10). As an essential initiator of autophagy, this protein can be a key stimulator of autophagy proteins, which leads to formation of the central complex of Bcl-1, VPS34 and VPS15. Beclin1 is also a key determinant of cells exposed to autophagy or apoptosis (11).
Of three LC3 isoforms expressed in mammalian tissues (LC3-I, LC3-II, LC3-III), LC3-ll is associated with autophagy (1(2. Various stressors can strongly regulate LC3 expression and turns it into a cytosolic form. Moreover, LC3-II has been considered as the most reliable autophagy index so far (13).
Atorvastatin is a statin that stops the conversion of mevalonate to hydroxy β-methylglutaryl-CoA by inhibiting 3-hydroxymethylglutaryl coenzyme reductase, which will consequently reduce cholesterol production. Despite lowering blood cholesterol, this medicine has some antioxidant, anti-inflammatory, anti-apoptotic and tissue-protective effects in some pathological conditions (14, 15). Statins stimulate Langerhans cells to release more insulin in order to lower blood glucose. In general, this drug can inhibit diabetes-related pancreatic tissue damage and necrosis by limiting oxidative stress and pancreatic inflammation (16). However, statins have dose-dependent side effects on skeletal muscles such as congestion, muscle pain, weakness and acceleration of skeletal muscle decomposition, leading to cell death (17).
Since aging is associated with physiological changes, such as structural skeletal muscle change, it can enhance insulin resistance and diabetes. Given the limited number of studies in this regard, we aimed to investigate effects of continuous and interval aerobic exercise along with statin administration on Beclin1 and LC3 expression in old rats with type 2 diabetes.
                                                                                        
MATERIALS AND METHODS
In this experimental study, 63 old male Wistar rats (weighting 300-350 g) were selected. The animals were randomly divided into eight groups of  healthy control (CN), diabetic control (CD), diabetic + continuous exercise (CED), diabetic + interval exercise (IED), diabetic + atorvastatin (AD), diabetic + continuous exercise + atorvastatin (ACED), diabetic + interval exercise + atorvastatin (AIED) and saline (SD). Diabetes was induced in rats by intraperitoneal injection of 50 mg/kg streptozotocin. Blood samples were taken from the corners of the eye and glucose level of above 250 mg/dl confirm the induction of diabetes (18). All study procedures were carried out according to the standard guidelines of working with laboratory animals.
Before starting the main protocol, the rats became familiar with the exercise by running on a treadmill for five minutes, five sessions a week, at speed of 8-10 m/min. The exercise program consisted of two continuous and interval exercise protocols (19). Daily atorvastatin supplement (20 mg/kg) was intraperitoneally injected to the supplementation groups (18).
Forty eight hours after the last exercise session and after 10-12 hours of fasting, the rats were anesthetized by intraperitoneal injection of ketamine-xylazine, and soleus muscle tissues were separated and stored at -80 °C. Then, the samples were sent to the laboratory for measuring LC3I, LC3-II and Beclin1 expression via RT-PCR using specific primers (Table 1).
Table 1. The primers sequence for studied genes
Gene Type Sequences
LC3 I Forward 5'TGGGTGCTGGCTGGGTTGGGAG3'
Reverse 5'AAAGCCTCAGGTGGATGAGGG3'
LC3 II Forward 5'GAAACAGGTCAGGTGTATAGGA3'
Reverse 5'TCTGAGCAGTGGTGCATGTGGT3'
Beclin1 Forward
5'AGGCTGAGGCGGAGAGATTG3'
Reverse 5'TGTGGAAGGTGGCATTGAAGAC3'
GAPDH Forward 5'CAT ACT CAG CAC CAG CAT CAC C3'
Reverse 5'AAG TTC AAC GGC ACA GTC AAG G3'
 
Quantification of the values of target gene expression was performed using the 2-CTΔΔ formula.
After confirming the normality of data distribution using the Shapiro–Wilk test, descriptive statistics including mean and standard deviation were used to describe the data. Inferential statistics, one-way ANOVA and Tukey post hoc test were used for data analysis. All statistical analyses were performed in SPSS 20 and at significance of 0.05.
 
RESULTS
Based on the results of ANOVA, LC3-I expression was significantly lower in AD, CED, IED, ACED and AIED groups than in the CD group (p=0.001) (Figure 1).
 
 As shown in figure 2, LC3-II expression differed significantly between the study groups (p<0.001). The LC3-II expression level in groups AD, CED, IED, ACED and AIED was significantly lower than in the CD group (p=0.001).
 
Beclin1 expression was significantly lower in groups AD, CED, IED, ACED and AIED than in the CD group (p=0.001). However, there was no significant difference in Beclin1 expression between the CD group, the AD group and the two groups of ACED (p = 0.92) and AIED (p = 0.958)(Figure 3).
 
 DISCUSSION
The present study was conducted to investigate the effects of interval and continuous exercise along with atorvastatin supplementation on Beclin1, LC3-I and LC3-П expression in muscle of aged rats with type 2 diabetes mellitus. The results showed that continuous and interval exercise, atorvastatin supplementation and their combination significantly reduced Beclin1, LC3I and LC3-II expression in muscle of diabetic rats compared to the control diabetic group. Choi et al. reported that treadmill running significantly decreased body weight and improved biochemical indices and insulin resistance in obese rats. However, they reported no significant change in Beclin1 and LC3 levels (19). Our results provide new information on molecular pathways involved in muscular autophagy in diabetic rats.
During the aging process, autophagic dysfunction occurs in many organs and tissues. In this condition, cells are unable to maintain proteins and healthy microorganisms, which leads to cellular dysfunction and often cell death. This may make cells more vulnerable to stressors and cellular pathogens (20). In this regard, many studies have reported the positive effects of intense continuous and interval aerobic exercise on improving the autophagy process in healthy and sick rats (21,22).
Patients with type 2 diabetes have significant muscle atrophy, which is accelerated during aging. These changes may be due to the decreased activity of the Akt/mTOR pathway, which reduces the glucose uptake and protein synthesis (23). On the other hand, this pathway interacts with proteasome-ubiquitin and autophagy-lysosomal pathways, thereby increasing autophagy enzymes (24). Guan et al. showed that Beclin1 plays an important role in hippocampal cell autophagy in old diabetic rats. They also showed that Beclin1 expression is reduced in the hippocampus of old diabetic rats (25). Sun et al. showed that Beclin1 expression in diabetic rats was significantly higher than in healthy counterparts, indicating the initiation of cellular autophagy process (26). The autophagy process plays an important role in maintaining tissue and cellular homeostasis. Beclin1 is a key protein in autophagic, apoptotic and inflammatory processes (27). However, autophagy is mainly modulated via the interaction between the Beclin1 protein and members of the Bcl-2 family (28).
A limited number of studies have investigated the effect of exercise on Beclin1 modifications. In this regard, a study reported that endurance exercise did significantly affect Beclin1 level in the soleus muscle of obese mice (29). Accordingly, He et al. stated that the JNK1-Bcl-2 signaling activity and subsequent Beclin1-Bcl-2 complex degradation are critical for AMPK to regulate the change between autophagy and cellular apoptosis pathways in diabetic patients (30).
Our results showed that atorvastatin supplementation along with interval and continuous exercise significantly reduced LC3-I and LC3-II expression. It is known that LC3 can form a covalent bond to phospholipids, and the membrane vesicles components are autophagic (31). Talaei et al. reported that 40 mg/day statin could reduce inflammatory markers, such as leptin, C-reactive protein and tumor necrosis factor-α in diabetic patients (32). Mohammadi et al. showed that atorvastatin could inhibit the production of free radicals in diabetes (33). It has been reported that exercise could help reduce the side effects of statins. Azamian Jazi et al. showed that combination of endurance training and atorvastatin has a favorable effect on vascular endothelial growth factor expression in angiogenesis process following myocardial infarction (34). Mejías-Peña et al. reported that eight weeks of aerobic training could alter autophagy indices (35). In another study, the expression of Beclin1, Autophagy Related 12 and Lysosomal Associated Membrane Protein 2 increased following exercise (36). Another study demonstrated that eight weeks of swimming exercise five sessions a week increases the amount of Beclin1 protein (37).
In a study by Agha-Alinejad et al., six weeks of interval exercise reduced Bcl-2 and increased LC3 expression in tumor tissue of female rats with breast tumor (38). In our study, atorvastatin along with continuous and interval aerobic exercise significantly decreased LC3-1, Beclin1 and LC3-II expression. The anti-inflammatory and anti-oxidative role of atorvastatin in pathological conditions has been well-demonstrated (15, 39). The atorvastatin antioxidant property increased the active oxygen species resistance by increasing the antioxidant enzyme induced by exercise activity, thereby reducing the release rate of cytochrome and initiating the autophagic process in the skeletal muscle of diabetic rats. The level of active oxygen species is high in animals and humans with type 2 diabetes (40).
Kim et al. reported that a 50-min running session at the speed of 12 m/min could significantly decrease LC3 and Beclin1 levels in the skeletal muscle (41). Brent et al. stated that exercise intensity is an important and effective variable in LC3-II and LC3-I protein content. In our study, there was a significant difference in the LC3-II/LC-I ratio between the continuous and interval exercise groups. Consistent with this result, a study showed that LC3-II decreased significantly 3, 6 and 12 hours after one treadmill running session but did not change significantly immediately after the exercise (39).
 
CONCLUSION
Diabetes in older people is associated with autophagy-mediated skeletal muscle atrophy. The results of our study showed that the continuous and interval exercise program alone and combined with atorvastatin could significantly reduce the LC3-I, LC3-II and Beclin1 levels in the skeletal muscles of old diabetic rats.
 
ACKNOWLEDGMENTS
The authors would like to express their sincere gratitude to all those who helped us to improve the quality of this research.
 
DECLARATIONS
Funding
This research was conducted at the personal expense of researcher Dr. Farnaz Zanganeh.
 
Ethics approvals and consent to participate
Ethics approval was obtained from the local ethics committee. All experiments involving animals were carried out according to the Guide for the Care and Use of Laboratory Animals.
 
Conflicts of interest
The authors declare that there is no conflict of interest.
Research Article: Original Paper | Subject: Sport Physiology
Received: 2019/12/17 | Accepted: 2020/01/15 | Published: 2021/12/29 | ePublished: 2021/12/29

References
1. Paredes-López O, Cervantes-Ceja ML, Vigna-Pérez M, Hernández-Pérez T. Berries: improving human health and healthy aging, and promoting quality life-a review. Plant Foods Hum Nutr 2010;65(3):299-308. [View at Publisher] [DOI:10.1007/s11130-010-0177-1] [PubMed] [Google Scholar]
2. Habibi A, Nemadi-Vosoughi M, Habibi S, Mohammadi M. Quality of life and prevalence of chronic illnesses among elderly people: A cross-sectional survey. J Health. 2012; 3(1): 58-66. [View at Publisher] [Google Scholar]
3. Gong Z, Muzumdar RH. Pancreatic function, type 2 diabetes, and metabolism in aging. Inter J endocrinol. 2012;2012. [View at Publisher] [DOI:10.1155/2012/320482] [PubMed] [Google Scholar]
4. Duntas L,Orgiazzi J , Brabant G.The interface between Thyroid and Diabetes mellitus. clin Endocrinol. 2011; 75: 1-9. [View at Publisher] [DOI:10.1111/j.1365-2265.2011.04029.x] [Google Scholar]
5. Wild S, Roglic G, Green A, Sicree R, King H. Global prevalence of diabetes: Estimates for the year 2000 and projections for 2030. Diabetes Care. 2004;27:1047-1053. [View at Publisher] [DOI:10.2337/diacare.27.5.1047] [Google Scholar]
6. Saini V. Molecular mechanisms of insulin resistance in type 2 diabetes mellitus. World J diabetes. 2010; 1(3): 68. [DOI:10.4239/wjd.v1.i3.68] [PubMed] [Google Scholar]
7. Pasiakos SM, Carbone JW. Assessment of skeletal muscle proteolysis and the regulatory response to nutrition and exercise. IUBMB life. 2014; 66(7): 478-84. [View at Publisher] [DOI:10.1002/iub.1291] [PubMed] [Google Scholar]
8. Pagano AF, Py G, Bernardi H, Candau RB, Sanchez AM. Autophagy and protein turnover signaling in slow-twitch muscle during exercise. Med Sci Spor Exe. 2014; 46(7): 1314-25. [DOI:10.1249/MSS.0000000000000237] [PubMed] [Google Scholar]
9. Islam M, Sooro M, Zhang P. Autophagic regulation of p62 is critical for cancer therapy. InterJ Mol Sci. 2018; 19(5): 1405. [View at Publisher] [DOI:10.3390/ijms19051405] [PubMed] [Google Scholar]
10. Wirawan E, Lippens S, Vanden Berghe T, Romagnoli A, Fimia GM, Piacentini M, et al. Beclin1: a role in membrane dynamics and beyond. Autophagy. 2012;8(1):6-17. [View at Publisher] [DOI:10.4161/auto.8.1.16645] [PubMed] [Google Scholar]
11. Eskelinen E-L, Saftig P. Autophagy: a lysosomal degradation pathway with a central role in health and disease. Biochim Biophys Acta. 2009; 1793(4): 664-73. [View at Publisher] [DOI:10.1016/j.bbamcr.2008.07.014] [PubMed] [Google Scholar]
12. Wang J, Pan X-L, Ding L-J, Liu D-Y, Lei D-P, Jin T. Aberrant expression of Beclin1 and LC3 correlates with poor prognosis of human hypopharyngeal squamous cell carcinoma. PloS one. 2013; 8(7): e69038. [DOI:10.1371/journal.pone.0069038] [PubMed] [Google Scholar]
13. Kang R, Zeh H, Lotze M, Tang D. The Beclin 1 network regulates autophagy and apoptosis. Cell Death Differ. 2011;18(4):571. [View at Publisher] [DOI:10.1038/cdd.2010.191] [PubMed] [Google Scholar]
14. Brandt N, Dethlefsen MM, Bangsbo J, Pilegaard H. PGC-1α and exercise intensity dependent adaptations in mouse skeletal muscle. PloS one 2017;12(10):e0185993. [View at Publisher] [DOI:10.1371/journal.pone.0185993] [PubMed] [Google Scholar]
15. Arboix A, García-Eroles L, Oliveres M, Targa C, Balcells M, Massons J. Pretreatment with statins improves early outcome in patients with first-ever ischaemic stroke: a pleiotropic effect of statins or a beneficial effect of hypercholesterolemia? BMC neurology. 2010;10(1):47. [View at Publisher] [DOI:10.1186/1471-2377-10-47] [PubMed] [Google Scholar]
16. Mahdian H, Farzanegi P, Farzaneh-Hessari A. The effect of combined therapy with resveratrol, and continuous and interval exercises on levels of apoptotic biomarkers in heart tissue of male rats with non-alcoholic fatty liver. Feyz Journal of Kashan University of Medical Sciences. 2018;22(5):469-77. [Persian] [View at Publisher] [Google Scholar]
17. Di Stasi SL, MacLeod TD, Winters JD, Binder-Macleod SA. Effects of statins on skeletal muscle: a perspective for physical therapists. Phys Ther. 2010; 90(10): 1530-42. [DOI:10.2522/ptj.20090251] [PubMed] [Google Scholar]
18. Mozafari M, Pharm D, Ali Akbar Nekooeian, Mohammad Reza Panjeshahin1, Hamid Reza Zare The Effects of Resveratrol in Rats with Simultaneous Type 2 Diabetes and Renal Hypertension: a Study of Antihypertensive Mechanism. Iran J Med Sci March. 2015; 40(2): 152-160. [Persian] [View at Publisher] [DOI:10.1177/1934578X1501000232]
19. Choi DH, Cho JY. Effect of treadmill exercise on skeletal muscle autophagy in rats with obesity induced by a high-fat diet Do Keun Cho1. JENB (Journal of Exercise Nutrition & Biochemistry). 2017; 21(3): 26-34. [DOI:10.20463/jenb.2017.0013] [PubMed] [Google Scholar]
20. Markaki M, Metaxakis A, Tavernarakis N. The role of autophagy in aging: molecular mechanisms. Autophagy: Cancer, Other Pathologies, Inflammation, Immunity, Infection, and Aging: Elsevier; 2017: 123-38. [View at Publisher] [DOI:10.1016/B978-0-12-812146-7.00002-0] [Google Scholar]
21. Ghahremani M, Azarbaijani M, Piri M, Raoufi A. Effect of frequency aerobic exercise on expression of Bcl-2 and Bax gene in mice with myocardial infarction. Armaghane danesh 2018;22(6):781-91. [Persian]. [View at Publisher] [Google Scholar]
22. Siahkohian M, Asgharpour-arshad M, Bolboli L, Jafari A, Sheikhzadeh hesari F. Effect of 12-WeeksAerobicTraining on Some Indices of Skeletal Muscle Apoptosis in Male Rats. Med J Tabriz Uni Med Sciences Health Services. 2018;39(6):35-43. [Persian]. [View at Publisher] [Google Scholar]
23. Linden MA, Fletcher JA, Morris EM, Meers GM, Laughlin MH, Booth FW, Sowers JR, Ibdah JA, Thyfault JP, Rector RS. Treating NAFLD in OLETF Rats with Vigorous-Intensity Interval Exercise Training. Med Sci Sports Exerc. 2015; 47(3): 556-67. [DOI:10.1249/MSS.0000000000000430] [PubMed] [Google Scholar]
24. Perry BD, Caldow MK, Brennan-Speranza TC, Sbaraglia M, Jerums G, Garnham A, et al. Muscle atrophy in patients with Type 2 Diabetes Mellitus: roles of inflammatory pathways, physical activity and exercise. Exer Immunol Rev. 2016;22:94. [PubMed] [Google Scholar]
25. Guan Z-F, Zhou X-L, Zhang X-M, Zhang Y, Wang Y-M, Guo Q-L, et al. Beclin1-mediated autophagy may be involved in the elderly cognitive and affective disorders in streptozotocin-induced diabetic mice. Transl Neurodegener. 2016; 5(1): 22. [DOI:10.1186/s40035-016-0070-4] [PubMed] [Google Scholar]
26. Sun S, Zhang M, Lin J, Hu J, Zhang R, Li C, et al. Lin28a protects against diabetic cardiomyopathy via the PKA/ROCK2 pathway. Biochem Biophys Res Commun 2016;469(1):29-36. [View at Publisher] [DOI:10.1016/j.bbrc.2015.11.065] [PubMed] [Google Scholar]
27. Grip O, Janciauskiene S, Bredberg A. Use of atorvastatin as an anti‐inflammatory treatment in Crohn's disease. British J pharmacol. 2008;155(7):1085-92. [View at Publisher] [DOI:10.1038/bjp.2008.369] [PubMed] [Google Scholar]
28. Decuypere J-P, Parys JB, Bultynck G. Regulation of the autophagic bcl-2/beclin 1 interaction. Cells. 2012; 1(3): 284-312. [View at Publisher] [DOI:10.3390/cells1030284] [PubMed] [Google Scholar]
29. Do Keun Cho DHC, Cho JY. Effect of treadmill exercise on skeletal muscle autophagy in rats with obesity induced by a high-fat diet. J Exer Nut Biochem. 2017;21(3):26. [DOI:10.20463/jenb.2017.0013] [PubMed] [Google Scholar]
30. He C, Zhu H, Li H, Zou M-H, Xie Z. Dissociation of Bcl-2-Beclin1 complex by activated AMPK enhances cardiac autophagy and protects against cardiomyocyte apoptosis in diabetes. Diabetes. 2013; 62(4): 1270-81. [View at Publisher] [DOI:10.2337/db12-0533] [PubMed] [Google Scholar]
31. Giménez-Xavier P, Francisco R, Platini F, Pérez R, Ambrosio S. LC3-I conversion to LC3-II does not necessarily result in complete autophagy. Inter J Mol Med. 2008;22(6):781-5. [View at Publisher] [PubMed] [Google Scholar]
32. Talaei A, Mahmoudpoor M, Shahdost M . The Effect of Atorvastatin on Inflammatory Markers in Patients with Type Two Diabetes . Journal of Arak University of Medical Sciences 2018; 21 (4) :40-47. [Persian]. [View at Publisher]
33. Mohammadi MT, Ramezani Binabaj M, Mirjalili MH, Mojtaba, Jafari M, Salem F. Effect of atorvastatin on pancreatic oxidative stress in Streptozotocin-induced diabetic rat. Iranian Journal of Endocrinology and Metabolism. 2013;15(2):197-204. [Persian]. [View at Publisher] [Google Scholar]
34. Azamian Jazi A, Haffezi M R, Opera H, Abdi H. The Effect of Endurance Exercise Training and Atorvastatin on VEGF in Rat Following Experimental Myocardial Infarction. sjimu. 2016; 24(4): 21-31. [Persian]. [View at Publisher] [DOI:10.18869/acadpub.sjimu.24.4.21] [Google Scholar]
35. Mejías-Peña Y, Rodriguez-Miguelez P, Fernandez-Gonzalo R, Martínez-Flórez S, Almar M, de Paz JA, et al. Effects of aerobic training on markers of autophagy in the elderly. Age. 2016;38(2):33. [DOI:10.1007/s11357-016-9897-y] [PubMed] [Google Scholar]
36. Mejías-Peña Y, Estébanez B, Rodriguez-Miguelez P, Fernandez-Gonzalo R, Almar M, de Paz JA, et al. Impact of resistance training on the autophagy-inflammation-apoptosis crosstalk in elderly subjects. Aging (Albany NY). 2017; 9(2): 408-418. [View at Publisher] [DOI:10.18632/aging.101167] [PubMed] [Google Scholar]
37. Ju J-s, Jeon S-i, Park J-y, Lee J-y, Lee S-c, Cho K-j, et al. Autophagy plays a role in skeletal muscle mitochondrial biogenesis in an endurance exercise-trained condition. J Physiol Sci. 2016; 66(5): 417-30. [View at Publisher] [DOI:10.1007/s12576-016-0440-9] [PubMed] [Google Scholar]
38. Agha-Alinejad H, Hashemi Jokar E. Effect of Six Weeks of Interval Exercise Training along with Selenium Nanoparticle Ingestion on Bcl-2 and LC3 Genes expression in the Tumor Tissue of Breast Tumor-Bearing Mice. ijbd. 2019; 12(2): 26-37.[Persian] [View at Publisher] [DOI:10.30699/acadpub.ijbd.12.2.26] [Google Scholar]
39. Brandt N, Nielsen L, Thiellesen Buch B, Gudiksen A, Ringholm S, Hellsten Y, et al. Impact of β-adrenergic signaling in PGC-1α-mediated adaptations in mouse skeletal muscle. Am J Physiol Endocrinol Metab. 2018; 314(1): E1-E20. [View at Publisher] [DOI:10.1152/ajpendo.00082.2017] [PubMed] [Google Scholar]
40. Akopova O, Kolchinskaya L, Nosar V, Bouryi V, Mankovska I, Sagach V. Cytochrome C as an amplifier of ROS release in mitochondria. Fiziol Zh 2012; 58(1): 3-12. [DOI:10.15407/fz58.01.003] [PubMed] [Google Scholar]
41. Kim YA, Kim YS, Song W. Autophagic response to a single bout of moderate exercise in murine skeletal muscle. J physiol biochem. 2012; 68(2): 229-35. [View at Publisher] [DOI:10.1007/s13105-011-0135-x] [PubMed] [Google Scholar]

Add your comments about this article : Your username or Email:
CAPTCHA

Send email to the article author


Rights and permissions
Creative Commons License This work is licensed under a Creative Commons Attribution-NonCommercial 4.0 International License.