Volume 16, Issue 1 (Jan-Feb 2022)                   mljgoums 2022, 16(1): 32-39 | Back to browse issues page


XML Print


Download citation:
BibTeX | RIS | EndNote | Medlars | ProCite | Reference Manager | RefWorks
Send citation to:

Torabi H, Eizadi M, Jalalvand A, Zarrinkalam E. Anti-Diabetic Effect of Long-Term Aerobic Training in Type 2 Diabetic Rats with Emphasis on Adiponectin Expression in Subcutaneous Adipose Tissue. mljgoums 2022; 16 (1) :32-39
URL: http://mlj.goums.ac.ir/article-1-1345-en.html
1- Department of Exercise Physiology, Borujerd Branch, Islamic Azad University, Borujerd, Iran
2- Department of Exercise Physiology, Saveh Branch, Islamic Azad University, Saveh, Iran , izadimojtaba2006@yahoo.com
3- Department of Sports Biomechanics, Hamedan Branch, Islamic Azad University, Hamedan, Iran
4- Department of Exercise Physiology, Hamedan Branch, Islamic Azad University, Hamedan, Iran
Full-Text [PDF 682 kb]   (2747 Downloads)     |   Abstract (HTML)  (18302 Views)
Full-Text:   (3840 Views)
ABSTRACT
Background and objectives: Clinical evidence has demonstrated the important role of adiponectin in insulin signaling pathways in target tissue. The aim of this study was to determine effects of aerobic training on insulin sensitivity, glucose level, and adiponectin expression in subcutaneous adipose tissue of type 2 diabetic rats.
Methods: Type 2 diabetes was induced in 14 male wistar rats by intraperitoneal injection of nicotine amide and streptozotocin. The rats were randomly divided into an exercise group (n=7) and a control group (n=7). The rats in the exercise group performed aerobic training in from of treadmill running, five sessions a week, for 12 weeks. Subjects in the control group did not perform any training. Glucose level, insulin level, insulin sensitivity, and adiponectin expression in subcutaneous adipose tissue were determined at baseline and 48 hours after the lasting training session. Independent t-test was used for comparing the variables between the study groups.
Results: Aerobic training resulted in a significant increase in serum insulin (p=0.006), insulin sensitivity (p=0.003), and adiponectin expression in subcutaneous adipose tissue (p=0.037) compared with the control group. In addition, the training caused a significant decrease in fasting glucose level compared with the control group (p<0.001).
Conclusion: Based on these findings, the decrease in blood glucose may be attributed to the improvement of adiponectin-dependent insulin signaling pathways in adipose tissue in response to aerobic training. However, more cellular-molecular studies are needed to understand the mechanisms responsible for these changes.

Keywords: Aerobic training, Adiponectin expression, Insulin sensitivity, Type 2 diabetes

 
INTRODUCTION
Diabetes mellitus is one of the common diseases worldwide that currently affects over 451 million people worldwide, and this number is expected to rise to 693 million by 2045 (1). By 2025, the incidence of diabetes in developing and developed countries is expected to increase by 70% and 42% compared to 1995, respectively (2). The global prevalence of type 2 diabetes was estimated to be 8.6% in adults over 20 years and 20.1% in adults over the age of 65 (3).
Among anti-inflammatory cytokines, adiponectin is one of the most important regulators of glucose metabolism and blood lipids (4,5). Adiponectin is a 244-amino acid protein that is mainly secreted by adipose tissue. In humans, adiponectin is encoded by the AdipoQ gene on the 3q27 arm of chromosome 17. The human adiponectin gene has three exons that start at exon 2 and end at exon 3 (6). While decreased expression in target tissues (e.g. adipose and muscle tissues) is associated with increased insulin resistance and hyperglycemia, its prolonged overexpression in adipose tissue leads to decreased insulin resistance or increased insulin sensitivity (7).
Plasma adiponectin concentration is directly related to high-density lipoprotein levels and decreased inflammatory markers, suggesting that this anti-inflammatory cytokine affects cardiovascular disease by regulating plasma lipids and reducing chronic inflammation (8). Lower levels of plasma adiponectin have a negative correlation with insulin resistance (9) and are associated with cardiovascular disease (10). In contrast, other adipokines, such as tumor necrosis factor alpha (TNF-α) and resistin, which induce insulin resistance in obese or type 2 diabetic individuals, decrease adiponectin expression (11). A decrease in plasma adiponectin induces the onset of diabetes and decrease in insulin sensitivity in insulin-resistant animal models (12-14). Low plasma adiponectin levels are associated with incidence of type 2 diabetes (13, 14). Low plasma adiponectin has also been observed in other diseases related to insulin resistance, such as cardiovascular disease (15) and hypertension (16). Bidulescu et al. (2020) reported that the effective role of leptin in glycemic control is mediated by decreased adiponectin expression in obese individuals (17). Decreased activity of adiponectin receptors leads to adiponectin dysfunction in insulin-resistant individuals (18). Increased peroxisome proliferator-activated receptor alpha (PPAR-α) is associated with improved adiponectin activity and its receptors in adipose tissue, resulting in increased insulin sensitivity (19). Numerous laboratory studies on independent insulin signaling pathways have reported the insulin-sensitizing effects of adiponectin (20-22). Increasing the expression or consumption of adiponectin agonists, independent of plasma insulin levels, lower blood glucose levels and improve insulin resistance in obese rats (20-23). On the other hand, decreased adiponectin expression leads to increased insulin resistance and hyperglycemia in mice on a high-fat diet (24).
In healthy young individuals, an acute or chronic aerobic exercise session does not appear to affect plasma adiponectin levels (25, 26). However, chronic endurance training increases plasma adiponectin in adolescents or adults (27), obese adults (28), Caucasian whites with impaired glucose tolerance, and patients with type 2 diabetes (29, 30). On the other hand, long-term aerobic training leads to overexpression of adiponectin types 1 and 2 receptors in adipose tissue and skeletal muscle of people with normal glucose tolerance and type 2 diabetic patients (29-31). On the other hand, some studies suggest that aerobic exercise does not alter adiponectin expression in obese individuals (32), insulin-resistant women (33), and type 2 diabetics (34). The inconsistency of findings in this regard may be related to multiple factors such as the study population, pathological conditions, type and intensity of training, duration of training, and type of tissue studied. In the present study, we evaluate effects of a course of aerobic training on glucose levels, insulin sensitivity, and adiponectin expression in subcutaneous adipose tissue of type 2 diabetic rats.
 
MATERIALS AND METHODS
Study population
In this applied experimental study, 14 male Wistar rats aged 10-week-old and weighing 220±20 g were obtained from the Pasteur Institute of Tehran, Iran. The rats were randomly assigned to an aerobic training group (n=7) and a control group (n=7). The animals were kept under standardized conditions (12-h light/dark cycle, 25 ± 2 °C, and humidity of 45-55 %). The study was approved by the Department of Exercise Physiology of Islamic Azad University, Borujerd Branch, Iran  and  carried  out  in  accordance  with  CPCSEA (Committee  for  the  Purpose  of  Control  and  Supervision  of Experiment on Animal) guidelines.
 
Induction of type 2 diabetes
After one week of familiarization with the environment, type 2 diabetes was induced in the subjects via a single intraperitoneal (i.p.) injection of 60 mg/kg streptozotocin (dissolved in citrate buffer, pH 4.5), 15 min after the i.p. administration of 95 mg/kg of nicotinamide (dissolved in normal saline) (35). Hyperglycemia was confirmed by detecting elevated blood glucose level seven days after the injection, and only animals with fasting blood glucose level of 150-400 mg/dl were used in the experiments (35).
 
Training protocol
Aerobic training was performed in form of treadmill running, five sessions a week for 12 weeks, with a gradual increase in speed (18 to 26 meters per minute) and time (10 to 55 minutes) (36). Subjects in the control group did not perform any training.
 
Table 1. Training time and intensity during the training period
 
Weeks 1 2, 3 4, 5 6, 7 8,9 10, 11, 12
Exercise time (min) 10 20 30 40 50 55
Speed of running (m/min) 18 20 22 22 24 26
 
Blood and tissue sampling
Forty eight hours after the last training session and after 10 to 12 hours of fasting, the rats were anesthetized by i.p. injection of a mixture of ketamine 10% (50 mg/kg) and xylosine 2% (10 mg/kg). Next, the animals' chest was dissected and a blood sample was taken directly from the animal's heart to ensure minimal animal harm. Subcutaneous adipose tissue was sampled and washed in physiological serum. Then, the samples were immersed in RNAlater fluid with a ratio of 20% for molecular experiments. Glucose concentration was measured by enzymatic colorimetric method with glucose oxidase (Pars Azmoun kit, Iran). Serum insulin was measured by enzyme-linked immunosorbent assay (ELISA)  method using a commercial kit (Demeditec, Diagnostic insulin ELIZA, Germany). Fasting glucose and insulin levels were used to calculate insulin sensitivity (37) using the following formula:  Insulin sensitivity = 1 / [Log (fasting insulin) + Log (fasting Glucose)].
 
RNA extraction and Real time–PCR
RNA extraction was done using the QIAGEN commercial RNeasy mini kit (Cat No: Q74124, QIAGEN, Germany) (38). Adiponectin mRNA level was determined by Real-time PCR by Rotorgen 6000 system using One Step SYBR TAKARA kit (Cat No: BS584-BioBasic). Melting curve analysis was performed at the end of the PCR cycle to determine the validity of the expected PCR product. RNA polymerase II was used as a control gene. Adiponectin gene primer (target gene) and polymerase II as control gene (Housekeeping) were synthesized by Pishgam Biotech Co. (Iran). The Oligo 7 Primer Analysis Software was used to design the primers based on the adiponectin gene (Table 2).
 
Table 2. Sequence of the primers used in the real-time RT-PCR experiment
Genes Primer sequence Product size T m Gene Bank
Adiponectin For: AGGATGTGAAAGTGAGCCTCTTC
Rev: GGAGGAGCATGGAGCCAGAG
159 bp 60  
NM_001191052.1
RNA Polymrase ΙΙ For: ACTTTGATGACGTGGAGGAGGAC
Rev: GTTGGCCTGCGGTCGTTC
164 bp 60  
XM_008759265.1
 
Data analysis
Data were expressed as mean ± standard deviation. The Shapiro-vilk test was used to ensure normal distribution of data. Comparison of variables between the two groups was performed using independent t-test. All statistical analyses were performed using SPSS (version 16). P-values less than 0.05 were considered significant.
 
RESULTS
Aerobic training significantly decreased body weight in the exercise group compared with the control group (p<0.001). Based on the results of the independent t-test, adiponectin expression in subcutaneous fatty tissue was significantly higher in the exercise group than in the control group (p=0.037) (Figure 1). Aerobic training caused a significant increase in serum insulin (p=0.009) (Figure 2) and insulin sensitivity (p=0.003) (Figure 3) as well as a significant decrease in fasting glucose (p<0.001) (Figure 4) compared with the control group.

DISCUSSION
Our results showed increased adiponectin expression in the subcutaneous adipose tissue of diabetic rats in response to aerobic training. In addition, aerobic training was associated with decreased glucose and increased serum insulin and insulin sensitivity levels. The decrease in glucose level and increase in serum insulin can be attributed to increased insulin sensitivity in response to aerobic training. On the other hand, the increased insulin sensitivity itself may be due to adiponectin overexpression in subcutaneous adipose tissue. The results of studies on glucose and insulin homeostasis changes in response to exercise training have been contradictory. Maltais et al. reported no change in insulin and glucose after four months of resistance training (39). In another study, 20 weeks of exercise, three to five sessions a week at intensity of 70% VO2max did not change HbA1C level (40). However, Glans et al. reported a significant reduction in glucose after six months of aerobic and resistance trainings in diabetic patients (41). In another study, increased insulin secretion from isolated pancreatic islets was reported after eight weeks of aerobic swimming (42). In a study by Lopes (2016), decrease in blood glucose after 12 weeks of combined exercise was attributed to increased insulin sensitivity in response to exercise training (43). In the study of Abd El-Kader et al. (2013), the improvement of HbA1C in type 2 diabetic patients after 12 weeks of moderate-intensity aerobic exercise was attributed to insulin function in the target tissue or increased insulin sensitivity (44). Lee et al. also reported an increase in insulin sensitivity in response to 12 weeks of aerobic and resistance trainings (45). Based on the evidence, it can be concluded that the improvement of insulin sensitivity in our study may be attributed to the increased adiponectin expression in subcutaneous adipose tissue in response to aerobic exercise. However, Polak et al. reported no change in plasma levels of adiponectin and adiponectin expression in abdominal subcutaneous adipose tissue (biopsy) after 12 weeks of aerobic exercise in obese women (32). In a study by Dai et al., six months of endurance training, five sessions/week increased serum adiponectin and adiponectin expression in skeletal muscle but did not change adiponectin expression in adipose tissue of Sprague Davley rats (46). Francine et al. also reported increased insulin sensitivity and insulin function in the liver as well as increased plasma levels of adiponectin in response to 10 weeks of aerobic exercise in laboratory rats (47). Min et al. also reported an increase in protein levels and adiponectin expression in adipose tissue and a significant decrease in glucose and insulin resistance after eight weeks of aerobic training in rats fed a high-fat diet (48). Asilah et al. reported that 12 weeks of intermittent exercise resulted in a 2-fold increase in adiponectin 1 receptor expression and a 33% increase in insulin sensitivity in obese individuals (49). Mostowik et al. also reported an increase in serum adiponectin by 12 weeks of aerobic training (50). In a previous study, 12 weeks of aerobic training in form of 40 minutes of jogging/running (at 60-75% of maximum heart rate) resulted in a significant increase in adiponectin expression, insulin sensitivity, VO2max, and serum adiponectin level which were accompanied with a reduction in abdominal obesity in young men. These findings suggest that increased serum levels and expression of adiponectin in blood mononuclear cells through exercise training can improve insulin sensitivity and glucose homeostasis (51).
Experimental evidence indicates a decrease in expression of adiponectin receptors in visceral adipose tissue of humans, experimental rats, and insulin-resistant redonts. This suggests adiponectin dysfunction due to decreased activity of its receptors in insulin-resistant animals (52, 53). In addition, it has been observed that activation of adiponectin agonists by PPARα in diabetic rats stimulates the function of adiponectin in adipose tissue by increasing the expression of adiponectin and its receptors, which results in increased insulin sensitivity (54).
Adiponectin is highly expressed in 3T3L1 adipocytes as a separate type of adipocyte from white and brown adipose tissues in mice. In adipocytes, C / EBP, PPAR, and sterol-binding proteins (SREBP-1C) are involved in accelerating adipogenesis and increasing lipid storage, and insulin-dependent glucose transport (55). Transgenic adiponectin overexpression in ob/ob mice leads to morbid obesity by reducing energy expenditure; however, it significantly improves glucose metabolism by reducing macrophages in adipose tissue and reducing TNF-α expression in adipocytes (7). Genetic studies have shown that adiponectin accelerates IRS1 and AKT phosphorylation by inhibiting p70S6K, resulting in increased insulin sensitivity (25). In parallel, adiponectin reduces the inhibitory effect of the mTOR/p70S6K on insulin signaling pathways by activating the LKB1/AMPK/TSC1/2 pathway (56). On the other hand, increasing the expression or consumption of adiponectin agonists independent of plasma insulin levels lowers blood glucose levels and improves insulin sensitivity (27, 29). Measurement of protein levels or adiponectin expression alone does necessarily indicate the effectiveness of exercise on insulin signaling pathways, and hormonal components such as IL-6, TNF-α and resistin or various transcription factors such as IRS-1, PPARγ, and FOXO1s are involved in this pathway. The lack of measurement of these factors is a limitation of the present study.
Apart from the effective role of adiponectin’s serum or expression levels, the decrease in glucose level of diabetic rats in our study may be attributed to an increase in serum insulin in response to exercise. Independent of insulin changes in target tissues such as adipose tissue and muscles, increasing serum insulin in response to exercise leads to lower blood glucose and improved glycemic profile. In our study, due to partial destruction of the pancreas by injection of low-dose STZ, the synthesis and release of insulin from pancreatic beta cells was certainly reduced. Studies have shown that continuous exercise can repair pancreatic beta cells, which results in increased synthesis and secretion of insulin (57). In this regard, Eizadi et al. reported an increase in serum insulin with a decrease in blood glucose in response to intermittent aerobic training in type 2 diabetic rats (58).
 
CONCLUSION
Eight weeks of aerobic training improved glucose level and increased insulin sensitivity and adiponectin expression in subcutaneous adipose tissue of type 2 diabetic rats. Based on the effective role of adiponectin in insulin function, the decrease in glucose level can be attributed to the improvement of adiponectin-dependent insulin signaling pathways in subcutaneous adipose tissue in response to aerobic training.  However, understanding the mechanisms responsible for glucose changes in response to exercise requires further cellular-molecular studies.
 
ACKNOWLEDGMENTS
The authors would like to thank the staff of the Pasteur Institute of Tehran for cooperation in genetic testing.
 
DECLARATIONS
 
Funding
This research was funded by the Islamic Azad University, Borujerd Branch.
 
Ethics approvals and consent to participate
The study was approved by the Department of Exercise Physiology of Islamic Azad University, Borujerd Branch, Iran (ethical code: IR.IAU.B.REC.1399.010).
 
Conflict of interest
The authors declare that there is no conflict of interest.
Research Article: Original Paper | Subject: Sport Physiology
Received: 2020/11/16 | Accepted: 2021/01/1 | Published: 2021/12/29 | ePublished: 2021/12/29

References
1. Cho NH, Shaw JE, Karuranga S, Huang Y, da Rocha Fernandes JD, et al. IDF Diabetes Atlas: Global estimates of diabetes prevalence for 2017 and projections for 2045. Diabetes Res Clin Pract. 2018 ;138:271-281. [View at Publisher] [DOI:10.1016/j.diabres.2018.02.023] [PubMed] [Google Scholar]
2. Larejani B, Zahedi F. Epidemiology of diabetes mellitus in Iran. Iranian Journal Diabetes and Metabolism. 2001; 1(1):1-8. (In Persian). [View at Publisher] [Google Scholar]
3. Sheikh Abumasoudi R, Salarvand S, Fesharaki H, Atashi V, Moghimian M, Kashani F, et al. The effect of electronic education and Short Message Service on hemoglobin A1C, interdialytic weight gain and blood pressure in diabetic patients undergoing hemodialysis. Nursing and Midwifery Journal. 2015; 13(7):9-620. (In Persian). [View at Publisher] [Google Scholar]
4. Meigs JB. The metabolic syndrome. BMJ. 2003 12;327(7406):61-2. [View at Publisher] [DOI:10.1136/bmj.327.7406.61] [PubMed] [Google Scholar]
5. Trujillo ME, Scherer PE. Adiponectin--journey from an adipocyte secretory protein to biomarker of the metabolic syndrome. J Intern Med. 2005 ;257(2):167-75. [View at Publisher] [DOI:10.1111/j.1365-2796.2004.01426.x] [PubMed] [Google Scholar]
6. Takahashi M, Arita Y, Yamagata K, Matsukawa Y, Okutomi K, Horie M, Shimomura I, Hotta K, Kuriyama H, Kihara S, Nakamura T, Yamashita S, Funahashi T, Matsuzawa Y. Genomic structure and mutations in adipose-specific gene, adiponectin. Int J Obes Relat Metab Disord. 2000 ;24(7):861-8. [View at Publisher] [DOI:10.1038/sj.ijo.0801244] [PubMed] [Google Scholar]
7. Kim JY, van de Wall E, Laplante M, Azzara A, Trujillo ME, Hofmann SM, et al. Obesity-associated improvements in metabolic profile through expansion of adipose tissue. J Clin Invest. 2007 ;117(9):2621-37. [DOI:10.1172/JCI31021] [PubMed] [Google Scholar]
8. Kantartzis K, Rittig K, Balletshofer B, Machann J, Schick F, Porubska K, et al . The relationships of plasma adiponectin with a favorable lipid profile, decreased inflammation, and less ectopic fat accumulation depend on adiposity. Clin Chem. 2006 ;52(10):1934-42. [View at Publisher] [DOI:10.1373/clinchem.2006.067397] [PubMed] [Google Scholar]
9. Chandran M, Phillips SA, Ciaraldi T, Henry RR. Adiponectin: more than just another fat cell hormone? Diabetes Care. 2003 ;26(8):2442-50. [DOI:10.2337/diacare.26.8.2442] [PubMed] [Google Scholar]
10. Pischon T, Girman CJ, Hotamisligil GS, Rifai N, Hu FB, Rimm EB. Plasma adiponectin levels and risk of myocardial infarction in men. JAMA 2004; 291:1730-7. [DOI:10.1001/jama.291.14.1730] [PubMed] [Google Scholar]
11. Hu E, Liang P, Spiegelman BM. AdipoQ is a novel adipose-specific gene dysregulated in obesity. J Biol Chem. 1996 3;271(18):10697-703. [View at Publisher] [DOI:10.1074/jbc.271.18.10697] [PubMed] [Google Scholar]
12. Hotta K, Funahashi T, Bodkin NL, Ortmeyer HK, Arita Y, Hansen BC,et al. Circulating concentrations of the adipocyte protein adiponectin are decreased in parallel with reduced insulin sensitivity during the progression to type 2 diabetes in rhesus monkeys. Diabetes. 2001 ;50(5):1126-33. [View at Publisher] [DOI:10.2337/diabetes.50.5.1126] [PubMed] [Google Scholar]
13. Daimon M, Oizumi T, Saitoh T, Kameda W, Hirata A, Yamaguchi H, et al. Decreased serum levels of adiponectin are a risk factor for the progression to type 2 diabetes in the Japanese Population: the Funagata study. Diabetes Care. 2003 ;26(7):2015-20. [View at Publisher] [DOI:10.2337/diacare.26.7.2015] [PubMed] [Google Scholar]
14. Nayak BS, Ramsingh D, Gooding S, Legall G, Bissram S, Mohammed A, et al. Plasma adiponectin levels are related to obesity, inflammation, blood lipids and insulin in type 2 diabetic and non-diabetic Trinidadians. Prim Care Diabetes. 2010 ;4(3):187-92. [View at Publisher] [DOI:10.1016/j.pcd.2010.05.006] [PubMed] [Google Scholar]
15. Pischon T, Girman CJ, Hotamisligil GS, Rifai N, Hu FB, Rimm EB. Plasma adiponectin levels and risk of myocardial infarction in men. JAMA. 2004 14;291(14):1730-7. [DOI:10.1001/jama.291.14.1730] [PubMed] [Google Scholar]
16. Adamczak M, Wiecek A, Funahashi T, Chudek J, Kokot F, et al. Decreased plasma adiponectin concentration in patients with essential hypertension. Am J Hypertens. 2003 ;16(1):72-5. [View at Publisher] [DOI:10.1016/S0895-7061(02)03197-7] [PubMed] [Google Scholar]
17. Bidulescu A, Dinh PC Jr, Sarwary S, Forsyth E, Luetke MC, King DB,et al. Associations of leptin and adiponectin with incident type 2 diabetes and interactions among African Americans: the Jackson heart study. BMC Endocr Disord. 2020 4;20(1):31. [View at Publisher] [DOI:10.1186/s12902-020-0511-z] [PubMed] [Google Scholar]
18. Bauer S, Weigert J, Neumeier M, Wanninger J, Schäffler A, Luchner A, et al. Low-abundant adiponectin receptors in visceral adipose tissue of humans and rats are further reduced in diabetic animals. Arch Med Res. 2010 ;41(2):75-82. [View at Publisher] [DOI:10.1016/j.arcmed.2010.02.010] [PubMed] [Google Scholar]
19. Ye JM, Doyle PJ, Iglesias MA, Watson DG, Cooney GJ, Kraegen EW. Peroxisome proliferator-activated receptor (PPAR)-_ activation lowers muscle lipids and improves insulin sensitivity in high fat-fed rats. Diabetes 2001; 50: 411-417. [View at Publisher] [DOI:10.2337/diabetes.50.2.411] [PubMed] [Google Scholar]
20. Berg AH, Combs TP, Du X, Brownlee M, Scherer PE. The adipocyte-secreted protein Acrp30 enhances hepatic insulin action. Nat Med. 2001 ;7(8):947-53. [View at Publisher] [DOI:10.1038/90992] [PubMed] [Google Scholar]
21. Combs TP, Berg AH, Obici S, Scherer PE, Rossetti L. Endogenous glucose production is inhibited by the adipose-derived protein Acrp30. J Clin Invest. 2001 ;108(12):1875-81. [View at Publisher] [DOI:10.1172/JCI14120] [PubMed] [Google Scholar]
22. Fruebis J, Tsao TS, Javorschi S, Ebbets-Reed D, Erickson MR, Yen FT, et al. Proteolytic cleavage product of 30-kDa adipocyte complement-related protein increases fatty acid oxidation in muscle and causes weight loss in mice. Proc Natl Acad Sci U S A. 2001 13;98(4):2005-10. [View at Publisher] [DOI:10.1073/pnas.98.4.2005] [PubMed] [Google Scholar]
23. Yamauchi T, Kamon J, Waki H. Globular adiponectin protected ob/ob mice from diabetes and ApoE-deficient mice from atherosclerosis. J. Biol. Chem. 2003; 278: 2461-2468. [View at Publisher] [DOI:10.1074/jbc.M209033200] [PubMed] [Google Scholar]
24. Nawrocki AR, Rajala MW, Tomas E. Micelackingadiponectinshow decreased hepatic insulin sensitivity and reduced responsiveness to peroxisome proliferator-activated receptor g agonists. J. Biol. Chem. 2006; 281: 2654-2660. [View at Publisher] [DOI:10.1074/jbc.M505311200] [Google Scholar]
25. Ferguson MA, White LJ, McCoy S, Kim HW, Petty T, Wilsey J. Plasma adiponectin response to acute exercise in healthy subjects. Eur J Appl Physiol. 2004 ;91(2-3):324-9. [View at Publisher] [DOI:10.1007/s00421-003-0985-1] [PubMed] [Google Scholar]
26. Punyadeera C, Zorenc AH, Koopman R, McAinch AJ, Smit E, Manders R, et al. The effects of exercise and adipose tissue lipolysis on plasma adiponectin concentration and adiponectin receptor expression in human skeletal muscle. Eur J En‌docrinol 2005; 152:427-436. [DOI:10.1530/eje.1.01872] [PubMed] [Google Scholar]
27. Balagopal P, George D, Yarandi H, Funanage V, Bayne E. Reversal of obesity-related hypoadiponectinemia by lifestyle intervention: a controlled, randomized study in obese adolescents. J Clin Endocrinol Metab. 2005 ;90(11):6192-7. [View at Publisher] [DOI:10.1210/jc.2004-2427] [PubMed] [Google Scholar]
28. Kondo T, Kobayashi I, Murakami M. Effect of exercise on circulating adipokine levels in obese young women. Endocr J. 2006 ;53(2):189-95. [DOI:10.1507/endocrj.53.189] [PubMed] [Google Scholar]
29. Bluher M, Bullen JW, Lee JH, Kralisch S, Fasshauer M, Kloting N, et al. Circulating adiponec‌tin and expression of adiponectin receptors in human skeletal muscle: associations with metabolic parameters and insulin resistance and regulation by physical training. J Clin Endocrinol Metab 2006; 91:2310-2316. [View at Publisher] [DOI:10.1210/jc.2005-2556] [PubMed] [Google Scholar]
30. Oberbach A, Tonjes A, Kloting N, Fasshauer M, Kratzsch J, Busse MW, et al. Effect of a 4 week physical training program on plasma concentrations of inflammatory markers in pa‌tients with abnormal glucose tolerance. Eur J Endocrinol 2006; 154:577-585. [DOI:10.1530/eje.1.02127] [PubMed] [Google Scholar]
31. de Bem GF, Costa CA, Santos IB, Cristino Cordeiro VDS, de Carvalho LCRM, de Souza MAV, et al. Antidiabetic effect of Euterpe oleracea Mart. (açaí) extract and exercise training on high-fat diet and streptozotocin-induced diabetic rats: A positive interaction. PLoS One. 2018 19;13(6):e0199207. [View at Publisher] [DOI:10.1371/journal.pone.0199207] [PubMed] [Google Scholar]
32. Polak J, Klimcakova E, Moro C, Viguerie N, Berlan M, Hejnova J,et al. Effect of aerobic training on plasma levels and subcutaneous abdominal adipose tissue gene expression of adiponectin, leptin, interleukin 6, and tumor necrosis factor alpha in obese women. Metabolism. 2006 ;55(10):1375-81. [View at Publisher] [DOI:10.1016/j.metabol.2006.06.008] [PubMed] [Google Scholar]
33. Marcell TJ, McAuley KA, Traustadóttir T, Reaven PD. Exercise training is not associated with improved levels of C-reactive protein or adiponectin. Metabolism. 2005 ;54(4):533-41. [View at Publisher] [DOI:10.1016/j.metabol.2004.11.008] [PubMed] [Google Scholar]
34. Yokoyama H, Emoto M, Araki T, Fujiwara S, Motoyama K, Morioka T, et al. Effect of aerobic exercise on plasma adiponectin levels and insulin resistance in type 2 diabetes. Diabetes Care. 2004 ;27(7):1756-8. [DOI:10.2337/diacare.27.7.1756] [PubMed] [Google Scholar]
35. Eizadi M, Soory R, Ravasi A, Baesy K, Choobineh S. Relationship between TCF7L2 Relative Expression in Pancreas Tissue with Changes in Insulin by High Intensity Interval Training (HIIT) in Type 2 Diabetes Rats . JSSU. 2017; 24 (12) :981-993 [Google Scholar]
36. Eizadi M, Ravasi AA, Soori R, Baesi K, Choubineh S. Effect of three months aerobic training on TCF7L2 expression in pancreatic tissue in type 2 diabet es rats induced by streptozotocin- nicotinamide. Feyz 2017; 21(1): 1-8. [DOI:10.17795/ajmb-34014] [Google Scholar]
37. McAuley KA, Williams SM, Mann JI, Walker RJ, Lewis-Barned NJ, Temple LA, et al. Diagnosing insulin resistance in the general population. Diabetes Care. 2001 [DOI:10.2337/diacare.24.3.460] [PubMed] [Google Scholar]
38. Lopes FL, Desmarais J, Gevry NY, Ledoux S, Murphy BD. Expression of vascular endothelial growth factor isoforms and receptors Flt-1 and KDR during the peri-implantation period in the mink, Mustela vison. Biol Reprod. 2003 [View at Publisher] [DOI:10.1095/biolreprod.102.013441] [PubMed] [Google Scholar]
39. Maltais ML, Perreault K, Courchesne-Loyer A, Lagacé JC, Barsalani R, Dionne IJ. Effect of Resistance Training and Various Sources of Protein Supplementation on Body Fat Mass and Metabolic Profile in Sarcopenic Overweight Older Adult Men: A Pilot Study. Int J Sport Nutr Exerc Metab. 2016 Feb; 26(1):71-7. [DOI:10.1123/ijsnem.2015-0160] [Google Scholar]
40. Vancea DM, Vancea JN, Pires MI, Reis MA, Moura RB, Dib SA. Effect of frequency of physical exercise on glycemic control and body composition in type 2 diabetic patients. Arq Bras Cardiol. 2009 ;92(1):23-30. [DOI:10.1590/S0066-782X2009000100005] [PubMed] [Google Scholar]
41. Glans F, Eriksson KF, Segerström A, Thorsson O, Wollmer P, Groop L. Evaluation of the effects of exercise on insulin sensitivity in Arabian and Swedish women with type 2 diabetes. Diabetes Res Clin Pract. 2009 ;85(1):69-74. [View at Publisher] [DOI:10.1016/j.diabres.2009.04.018] [PubMed] [Google Scholar]
42. Oliveira CAM, Paiva MF, Mota CAS, Ribeiro C, Leme JACA, Luciano E, et al. Exercise at anaerobic threshold intensity and insulin secretion by isolated pancreatic islets of rats. Islets. 2010 ; 2(4):240-6. [DOI:10.4161/isl.2.4.12266] [PubMed] [Google Scholar]
43. Lopes WA, Leite N, da Silva LR, Brunelli DT, Gáspari AF, Radominski RB, et al. Effects of 12 weeks of combined training without caloric restriction on inflammatory markers in overweight girls. J Sports Sci. 2016 ;34(20):1902-12. [View at Publisher] [DOI:10.1080/02640414.2016.1142107] [PubMed] [Google Scholar]
44. Abd El-Kader S, Gari A, Salah El-Den A. Impact of moderate versus mild aerobic exercise training on inflammatory cytokines in obese type 2 diabetic patients: a randomized clinical trial. Afr Health Sci. 2013 ;13(4):857-63. [DOI:10.4314/ahs.v13i4.1] [PubMed] [Google Scholar]
45. Lee S, Norheim F, Langleite TM, Gulseth HL, Birkeland KI, Drevon CA. Effects of long-term exercise on plasma adipokine levels and inflammation-related gene expression in subcutaneous adipose tissue in sedentary dysglycaemic, overweight men and sedentary normoglycaemic men of healthy weight. Diabetologia. 2019 ;62(6):1048-1064. [View at Publisher] [DOI:10.1007/s00125-019-4866-5] [PubMed] [Google Scholar]
46. Dai Y, Pang J, Gong H, Fan W, Zhang TM. Roles and tissue source of adi‌ponectin involved in lifestyle modifications. J Gerontol A Biol Sci Med Sci 2013; 68:117-128. [View at Publisher] [DOI:10.1093/gerona/gls131] [PubMed] [Google Scholar]
47. de Carvalho FP, Moretto TL, Benfato ID, Barthichoto M, Ferreira SM, Costa-Júnior JM, et al. Central and peripheral effects of physical exercise without weight reduction in obese and lean mice. Biosci Rep. 2018 5;38(2):BSR20171033. [DOI:10.1042/BSR20171033] [PubMed] [Google Scholar]
48. Su M, Bai YP, Song WW, Wang M, Shen RR, Du KJ, et al. [Effect of exercise on adiponectin in aged obese rats]. Zhongguo Ying Yong Sheng Li Xue Za Zhi. 2018 8;34(4):345-349. Chinese. [PubMed] [Google Scholar]
49. Asilah Za'don NH, Amirul Farhana MK, Farhanim I, Sharifah Izwan TO, Appukutty M, Salim N, et al. High-intensity interval training induced PGC-1∝ and AdipoR1 gene expressions and improved insulin sensitivity in obese individuals. Med J Malaysia. 2019 ;74(6):461-467. PMID: 31929469. [PubMed] [Google Scholar]
50. Mostowik M, Gajos G, Zalewski J, Nessler J, Undas A. Omega-3 polyun‌saturated fatty acids increase plasma adiponectin to leptin ratio in sta‌ble coronary artery disease. Cardiovasc Drugs Ther 2013; 27:289-295. [DOI:10.1007/s10557-013-6457-x] [PubMed] [Google Scholar]
51. Lee SH, Hong HR, Han TK, Kang HS. Aerobic training increases the expression of adiponectin receptor genes in the peripheral blood mononuclear cells of young men. Biol Sport. 2015 ;32(3):181-6. [DOI:10.5604/20831862.1150298] [PubMed] [Google Scholar]
52. Krause MP, Milne KJ, Hawke TJ. Adiponectin-Consideration for its Role in Skeletal Muscle Health. Int J Mol Sci. 2019 27;20(7):1528. [DOI:10.3390/ijms20071528] [PubMed] [Google Scholar]
53. Bauer S, Weigert J, Neumeier M, Wanninger J, Schäffler A, Luchner A, et al. Low-abundant adiponectin receptors in visceral adipose tissue of humans and rats are further reduced in diabetic animals. Arch Med Res. 2010 ;41(2):75-82. [View at Publisher] [DOI:10.1016/j.arcmed.2010.02.010] [PubMed] [Google Scholar]
54. Ye JM, Doyle PJ, Iglesias MA, Watson DG, Cooney GJ, Kraegen EW. Peroxisome proliferator-activated receptor (PPAR)-alpha activation lowers muscle lipids and improves insulin sensitivity in high fat-fed rats: comparison with PPAR-gamma activation. Diabetes. 2001 ;50(2):411-7. [View at Publisher] [DOI:10.2337/diabetes.50.2.411] [PubMed] [Google Scholar]
55. Fu Y, Luo N, Klein RL, Garvey WT. Adiponectin promotes adipocyte differentiation, insulin sensitivity,and lipid accumulation.J. Lipid Res. 2005; 46: 1369-1379 [View at Publisher] [DOI:10.1194/jlr.M400373-JLR200] [PubMed] [Google Scholar]
56. Wang C, Mao X, Wang L, Liu M, Wetzel MD, Guan KL, et al. Adiponectin sensitizes insulin signaling by reducing p70 S6 kinase-mediated serine phosphorylation of IRS-1. J Biol Chem. 2007 16;282(11):7991-6. [View at Publisher] [DOI:10.1074/jbc.M700098200] [PubMed] [Google Scholar]
57. Sunmin P, Sang MH, Ji EL, So RS. Exercise improves glucose homeostasis that has been impaired by a high-fat diet by potentiating pancreatic β-cell function and mass through IRS2 in diabetic rats. Journal of Applied Physiology November 2007; 103(5): 1764-1771. [DOI:10.1152/japplphysiol.00434.2007] [PubMed] [Google Scholar]
58. Eizadi M, Soory R, Ravasi A, Baesy K, Choobineh S. Relationship between TCF7L2 Relative Expression in Pancreas Tissue with Changes in Insulin by High Intensity Interval Training (HIIT) in Type 2 Diabetes Rats . JSSU. 2017; 24 (12): 981-993. [Google Scholar]

Add your comments about this article : Your username or Email:
CAPTCHA

Send email to the article author


Rights and permissions
Creative Commons License This work is licensed under a Creative Commons Attribution-NonCommercial 4.0 International License.