Volume 16, Issue 3 (May-Jun 2022)                   mljgoums 2022, 16(3): 30-35 | Back to browse issues page


XML Print


Download citation:
BibTeX | RIS | EndNote | Medlars | ProCite | Reference Manager | RefWorks
Send citation to:

zojaji Z, farajtabar behrestaq S, askari B. Effect of Eight Weeks of High Intensity Interval Training on Insulin Resistance and IRS1 Gene Expression in Gastrocnemius Muscle of Obese Wistar Rats. mljgoums 2022; 16 (3) :30-35
URL: http://mlj.goums.ac.ir/article-1-1312-en.html
1- Department of Physical Education and Sport Sciences, Qaemshahr Branch, Islamic Azad University, Qaemshahr, Iran
2- Department of Physical Education and Sport Sciences, Qaemshahr Branch, Islamic Azad University, Qaemshahr, Iran , farajtabarp@yahoo.com
Full-Text [PDF 735 kb]   (3435 Downloads)     |   Abstract (HTML)  (14021 Views)
Full-Text:   (2930 Views)
INTRODUCTION
Scientific studies have identified obesity as an effective factor in the development of type 2 diabetes (1). Hyperinsulinemia  due to increased insulin release from the pancreas and insulin resistance are among the most common endocrine disorders in obesity (2). Glucose transport from the bloodstream to target tissues, especially skeletal muscles, is one of the most important functions of insulin (3). Studies in recent decades have demonstrated the role of genetic factors in the incidence of obesity and obesity-related metabolic diseases. It is believed that impaired expression of some genes may affect lipolysis or insulin function, thereby altering carbohydrate and fat metabolism. For example, genetic components such as FOXO1, PPARy, and FTO affect energy homeostasis as well as glucose and fat metabolism in target tissues of insulin, such as skeletal muscle and adipose tissue (4, 5). In fact, the association between PPARy and FTO levels with obesity, lipid profile, and insulin resistance has been well-demonstrated (5, 6). In the meantime, the insulin receptor substrate 1 (IRS1) gene is also of great importance as a cytoplasmic substrate of both insulin and insulin like growth factor 1 receptor components (7). Insulin exerts a wide range of growth and metabolic effects by binding to its receptor and activating the tyrosine kinase property. This ultimately leads to phosphorylation of tyrosine kinase residues on the surface of anchor proteins, including IRS proteins (8). According to studies, IRS1 plays important roles in insulin signaling pathways. Some studies have revealed that altered expression of IRS1 in insulin signaling pathways, especially along the PI3K kinase pathway, may lead to insulin resistance (7, 9). It has been reported that IRS1 protein expression increases after one day of exercise activity and declines by 50% after 16 hours of chronic exercise (five days of swimming) (10). High-intensity interval training (HIIT) is a highly time-efficient model of exercise that stimulates many metabolic adaptations to endurance and regular exercises (11). It is also effective in reducing body fat and insulin resistance (12). The present study investigates effects of eight weeks of HIIT on insulin signaling, glucose level, and IRS1 gene expression in obese rats.

MATERIALS AND METHODS
This experimental study was carried out on 14 10-week old male, Wistar rats (weighing 220 ± 20 g). The rats were purchased from the Baqiyatallah University of Medical Sciences, Tehran, Iran. Obesity was induced via exposure to a high-fat diet containing 1% cholesterol powder and 1% pure corn oil (Pars dam Food Company, Iran) for six weeks (13). Then, the rats were randomly divided into a training group (n=7) and a control group (n=7). The rats were kept in a 12:12-hour light–dark cycle, at controlled temperature (22±3 °C) and humidity (30%). The rats were handled by one person throughout the study period. All procedures were carried out according to the ethical considerations in the care of laboratory animals. The study protocol was approved by the ethics committee of the Institute of Physical Education and Sport Sciences (ethical code: IR.SSRI.REC.1399.651).
The rats became familiar with the laboratory environment for one week. They were also familiarized with running on treadmill for one week. The main training intervention started at the beginning of the 19th week. Rats in the training group were subjected to 30 minutes of treadmill running, five sessions a week, for eight weeks, with 40 seconds repetition and a 2-minute active rest between each repetition (14). The control group did not participate in any training. Both groups received the high-fat diet until the end of the study. Finally, all rats were dissected 48 hours after the last training session.
The details of the HIIT exercise program were as follows:
- In weeks 1 and 2: 8 repetitions of 40 seconds at speed of 25 m/min, with 2 minutes active rest between repetitions at 10 m/min (5% slope).
- In weeks 3 and 4: 10 repetitions of 40 seconds at speed of 28 m/min, with 2 minutes active rest between repetitions at 10 m/min (10% slope).
- In weeks 5 and 6: 10 repetitions of 40 seconds at speed of 32 m/min, with 2 minutes active rest between repetitions at 10 m/min (10% slope).
- In weeks 7 and 8: 10 repetitions of 40 seconds at speed of 36 m/min, with 2 minutes active rest between repetitions at 10 m/min (10% slope).
After overnight fasting, the rats were anesthetized by intraperitoneal injection of ketamine-xylosine, and blood samples were taken directly from the animal. The gastrocnemius muscle was then removed, washed with physiological serum, and placed in a microtube containing RNAlaterTM fluid with a ratio of 20%. Glucose concentration was measured by glucose oxidase method using a commercial kit (Pars Azmoun Co., Iran). Serum insulin was measured by enzyme-linked immunosorbent assay using a commercial kit (Demeditec Diagnostic, Germany). RNA extraction was performed using the RNeasy Mini Kit (Qiagen, Germancy) according to the manufacturer’s instructions (15). Next, IRS1 mRNA was quantified by RT-Real time PCR in the 6000 Rotagen System using the One Step SYBR kit (TAKARA BIO Inc. Japan) according to the company's instructions. The sequences of the primers used in the study are shown in table 1.

Table 1. The sequences of the primers used in the study
Genes Primer sequence (5` to 3`) Product size Tm (oC) Gene Bank
IRS1 Forward: GGCCATGAGCGATGAGTTTC
Reverse: GGCGGAGGATTGTTGAGATG

159 bp

60

NM_001191052.1
RNA PolymraseΙΙ Forward: ACTTTGATGACGTGGAGGAGGAC
Reverse: GTTGGCCTGCGGTCGTTC

164 bp

60

XM_008759265.1

Statistical analysis of data was performed using SPSS (version 16). The Kolmogorov-Smirnov test was used to assess normal distribution of data. The independent t-test was used to compare pretest and posttest values of body weight between the groups. The paired t-test was used to determine intra-group changes. The independent t-test was used to compare the dependent variables (glucose, serum insulin and IRS1) between the study groups. A p-value of less than 0.05 was considered statistically significant.

RESULTS
Based the results of the independent t-test, there was no significant difference in body weight between the two groups in the pretest stage (p=0.632). The results of the paired t-test showed a significant increase in body weight at the posttest stage compared to the pretest stage. However, there was no significant difference in the body weight between the two groups at the posttest stage (p=0.126).
Table 2. Body weight (g) before and after the intervention in the study groups
Group Pre-intervention Post-intervention p-value (paired t-test)
Control 275 ± 8.50 370 ± 4.93 <0.0001
HIIT 277 ± 6.6 364 ± 7.48 <0.0001
Sig (T test) P = 0.632 P = 0.126 -
Data are presented as mean ± standard deviation.

The expression of IRS1 in the gastrocnemius muscle differed significantly between the two groups (p=0.03). In other words, the HIIT training significantly increased IRS1 expression in the gastrocnemius muscle of obese Wistar rats (Tables 3).
Table 3. Relative expression of IRS1 in the gastrocnemius muscle of rats in the HIIT and control groups
p-value HIIT group Control group Variable
0.03 1.44± 0.47 1 Relative expression of IRS1

Fasting blood glucose, insulin, and insulin resistance were significantly lower in the HIIT group than in the control group (Table 4).
Table 4. Fasting glucose levels in the HIIT and control groups
p-value HIIT group Control group Variables
<0.0001 5± 96 4± 120 Glucose (mg/dL)
<0.0001 1.15± 6.37 0.72± 9.04 Insulin (µIU/ml)
<0.0001 0.34± 1.53 0.22± 2.68 (HOMA-IR)Insulin resistance


DISCUSSION
The findings of the present study indicated a decrease in fasting glucose level and insulin resistance following eight weeks of HIIT in insulin-resistant obese rats.  Racil et al. (2013) reported a decrease in triglyceride, total cholesterol, low-density lipoprotein, and insulin resistance in response to four weeks of moderate to high interval exercise in obese men (16). Tan et al. (2016) also reported significant reductions in glucose, triglyceride, and body fat mass along with increased lipoprotein lipase activity after 10 weeks of aerobic exercise in overweight women (17). In another study, 12 weeks of moderate-intensity aerobic training decreased glycosylated hemoglobin, glucose, and insulin resistance in type 2 diabetic men and women (18). Contrary to these studies, Maltais et al. (2016) reported that four months of resistance training did not change glucose and insulin levels in 26 overweight older men, although body fat mass decreased significantly (19). Bouchonville et al. (2013) also reported no change in triglyceride, adiponectin, and insulin resistance after 12 months of aerobic exercise in obese adults (20). The discrepancy in the findings regarding the response of type 2 diabetes markers to exercise in healthy and obese populations can be explained by differences in the type of exercise intervention, intensity, duration, repetition of exercise sessions, baseline level of fitness. On the other hand, a decrease in blood glucose can be partly attributed to an increase in insulin function at target tissue levels by regulating insulin receptor components, such as insulin receptor protein concentration, protein kinase B, increased IRS1, and glycogen synthesis as well as an increase in the number of glucose transporter proteins (21). Based on clinical evidence, a decrease in fasting glucose can be attributed in some ways to an increase in insulin function or a decrease in insulin resistance in response to interval exercise. In support of the findings of the present study regarding the reduction of insulin resistance in response to HIIT, a study by Ho et al. (2015) demonstrated that a 12-month weight loss program with diet restriction could significantly decrease insulin resistance and increase insulin sensitivity in overweight and obese individuals (22). The effectiveness of aerobic exercise on insulin resistance may be attributed to other exercise-induced changes. In this regard, Samjoo et al. (2013) reported that three months of moderate-intensity aerobic exercise improved oxidative stress markers as well as insulin resistance and inflammatory profile in obese individuals, independent of weight loss (23). The researchers noted that exercise has beneficial effects for reducing the risk factors associated with the pathogenesis of insulin resistance in obese populations. Some researchers have also attributed the decrease in blood glucose levels or glycemic profile to the improvement of inflammatory components in response to exercise. As mentioned earlier, improving insulin function at tissue levels plays a key role in improving the inflammatory profile. Steckling et al. (2016) demonstrated that glucose and HbA1C improvement after 12 weeks of HIIT at 70-90% of maximal heart rate is related to decrease in proinflammatory interleukins and increase in interleukin-10 levels (24).
Some recent studies have focused on the effect of genetic components on insulin signaling pathways. Others have considered the response of genetic components such as FOXO1, IRS1, PPT1B, and FTO that mediate insulin-dependent membrane glucose translocation in response to environmental stimuli, such as exercise. In this context, the eight-week HIIT increased IRS1 expression in the gastrocnemius muscle of insulin-resistant obese rats. Consistent with this finding, Kirwan et al. (2000) reported that people with higher level of physical activity had higher IRS1 levels in the presence of hyperinsulinemia. In addition, the level of PI3K activity associated with maximal oxygen uptake was higher in this population than in inactive counterparts (25). The elevated levels of IRS1 are important in maintaining balance or reducing hyperglycemia in obese individuals. Other studies have also reported a 20-30% increase in membrane glucose uptake following the increase in IRS1 levels in response to exercise training. Activation of IRS1 and PI3K is essential for glucose transporters activation in adipose and muscle tissues, and exercise activity is able to increase insulin receptor, IRS1, and MAP kinase activities in mammals (26). Moreover, continuous exercise activity could increase insulin sensitivity in target tissues of insulin (26). Another study also revealed that increased IRS1 expression may increase insulin sensitivity and decrease insulin resistance, thereby facilitating glucose transport into the cell membrane (27).

CONCLUSION
Our findings indicate that HIIT in form of treadmill running can increase insulin function in insulin-resistant obese rats. Given the important role of IRS1 in insulin signaling pathways, the decrease in insulin resistance and blood glucose levels may be attributed to the increased expression of IRS1 in the gastrocnemius muscle of rats in response to HIIT. However, understanding the mechanisms involved in the effect of HIIT training on insulin function requires further studies.

ACKNOWLEDGMENTS
The authors would like to express their sincere thanks to the staff of Islamic Azad University of Qaemshahr and the Pasteur Institute of Iran for their cooperation.

DECLARATIONS
Funding
The authors received no financial support for the research, authorship, and/or publication of this article.

Ethics approvals and consent to participate
All procedures were carried out according to the ethical considerations in the care of laboratory animals. The study protocol was approved by the ethics committee of the Institute of Physical Education and Sport Sciences (ethical code: IR.SSRI.REC.1399.651).

Conflict of interest
The authors declare that there is no conflict of interest regarding publication of this article.
Research Article: Original Paper | Subject: Sport Physiology
Received: 2020/08/19 | Accepted: 2021/02/26 | Published: 2022/05/14 | ePublished: 2022/05/14

References
1. Hersoug LG, Linneberg A. The link between the epidemics of obesity and allergic diseases: does obesity induce decreased immune tolerance? Allergy. 2007; 62(10): 1205-13. [View at Publisher] [DOI:10.1111/j.1398-9995.2007.01506.x] [PubMed] [Google Scholar]
2. Butler AE, Janson J, Bonner-Weir S, Ritzel R, Rizza RA, Butler PC. Beta-cell deficit and increased beta-cell apoptosis in humans with type 2 diabetes. Diabetes. 2003; 52: 102-110. [View at Publisher] [DOI:10.2337/diabetes.52.1.102] [PubMed]
3. Azizi F, Larijani B, Hossein panah F. Endicrine gland diseases. Endocrinology and Metabolism Research Center. 1ed. 1385.
4. Dowell P, Otto TC, Adi S, Lane MD. Convergence of peroxisome proliferator-activated receptor gamma and Foxo1 signaling pathways. J Biol Chem. 2003; 278(46): 45485-91. [View at Publisher] [DOI:10.1074/jbc.M309069200] [PubMed] [Google Scholar]
5. Tontonoz P, Spiegelman BM. Fat and beyond: The diverse biology of PPARgamma. Annu Rev Biochem. 2008; 77: 289-312. [View at Publisher] [DOI:10.1146/annurev.biochem.77.061307.091829] [PubMed] [Google Scholar]
6. Klöting N, Schleinitz D, Ruschke K, Berndt J, Fasshauer M, Tönjes A, et al. Inverse relationship between obesity and FTO gene expression in visceral adipose tissue in humans. Diabetologia. 2008; 51(4): 641-7. [View at Publisher] [DOI:10.1007/s00125-008-0928-9] [PubMed] [Google Scholar]
7. Almind K, Inoue G, Pederson O, Kahn CR. A common amino acid polymorphism in insulin receptor substrate-1 causes impaired insulin signaling. Evidence from transfection studies. J Clin Invest. 1996; 97: 2569-75. [View at Publisher] [DOI:10.1172/JCI118705] [PubMed] [Google Scholar]
8. White MF. The insulin signaling system and the IRS proteins. Diabetologia. 1997; 40: 2-17. [View at Publisher] [DOI:10.1007/s001250051387] [PubMed] [Google Scholar]
9. Jellema A, Zeegers MP, Feskens EJ, Dagnelie PC, Mensink RP. Gly972Arg variant in the insulin receptor substrate-1 gene and association with Type 2 diabetes: a meta-analysis of 27 studies. Diabetologia. 2003; 46: 990-5. [View at Publisher] [DOI:10.1007/s00125-003-1126-4] [PubMed] [Google Scholar]
10. Chibalin AV, Yu M, Ryder JW, Song XM, Galuska D, Krook A, et al. RExercise-induced changes in expression and activity of proteins involved in insulin signal transduction in skeletal muscle: differential effects on insulin-receptor substrates 1 and 2. Proc Natl Acad Sci USA. 2000; 97: 38-43. [View at Publisher] [DOI:10.1073/pnas.97.1.38] [PubMed] [Google Scholar]
11. Sharma N, Castorena CM, Cartee GD. Greater insulin sensitivity in calorie restricted rats occurs with unaltered circulating levels of several important myokines and cytokines. Nutr Metab (Lond). 2012; 9: 90-4. [View at Publisher] [DOI:10.1186/1743-7075-9-90] [PubMed] [Google Scholar]
12. Shaw K, Gennat H, O'Rourke P, Del Mar C. Exercise for Overweight or Obesity. Cochrane Database Syst Rev. 2006; 18(4): CD003817. [View at Publisher] [DOI:10.1002/14651858.CD003817.pub3] [PubMed] [Google Scholar]
13. Grygiel-Górniak B. Peroxisome proliferator-activated receptors and their ligands: nutritional and clinical implications--a review. Nutr J. 2014; 13: 17. [View at Publisher] [DOI:10.1186/1475-2891-13-17] [PubMed] [Google Scholar]
14. Kalhor H, Peeri M, Matin Homaee h, Izadi M. The Effect of 6 Weeks Resistance Training and HITT on GLP-1 Gene Expression of Diabetic Rats. Iranian Journal of Diabetes and Obesity. 2018; 10(1): 42-9. [View at Publisher] [Google Scholar]
15. Coughlin CC, Finck BN, Eagon JC, Halpin VJ, Magkos F, Mohammed BS, et al. Effect of marked weight loss on adiponectin gene expression and plasma concentrations. Obesity (Silver Spring) 2007; 15(3): 640-5. [View at Publisher] [DOI:10.1038/oby.2007.556] [PubMed] [Google Scholar]
16. Racil G, Ben Ounis O, Hammouda O, Kallel A, Zouhal H, Chamari K, Amri M. Effects of high vs. moderate exercise intensity during interval training on lipids and adiponectin levels in obese young females. Eur J Appl Physiol. 2013; 113(10): 2531-40. [View at Publisher] [DOI:10.1007/s00421-013-2689-5] [PubMed] [Google Scholar]
17. Tan S, Wang J, Cao L, Guo Z, Wang Y. Positive effect of exercise training at maximal fat oxidation intensity on body composition and lipid metabolism in overweight middle-aged women. Clin Physiol Funct Imaging. 2016; 36(3): 225-30. [View at Publisher] [DOI:10.1111/cpf.12217] [PubMed] [Google Scholar]
18. Abd El-Kader S, Gari A, Salah El-Den A. Impact of moderate versus mild aerobic exercise training on inflammatory cytokines in obese type 2 diabetic patients: a randomized clinical trial. Afr Health Sci. 2013; 13(4):857-63. [View at Publisher] [DOI:10.4314/ahs.v13i4.1] [Google Scholar]
19. Maltais ML, Perreault K, Courchesne-Loyer A, Lagacé JC, Barsalani R, Dionne IJ. Effect of Resistance Training and Various Sources of Protein Supplementation on Body Fat Mass and Metabolic Profile in Sarcopenic Overweight Older Adult Men: A Pilot Study. Int J Sport Nutr Exerc Metab. 2016; 26(1): 71-7. [View at Publisher] [DOI:10.1123/ijsnem.2015-0160] [PubMed] [Google Scholar]
20. Bouchonville M, Armamento-Villareal R, Shah K, Napoli N, Sinacore DR, Qualls C, Villareal DT. Weight loss, exercise or both and cardiometabolic risk factors in obese older adults: results of a randomized controlled trial. Int J Obes (Lond). 2013; 38: 423–431. [View at Publisher] [DOI:10.1038/ijo.2013.122] [Google Scholar]
21. Asarzadeh Noshabadi M, Abedi B. The effect of combained training on insulin resistance and some inflammation determinants in sedentary males. Quarterly of Ofoghe Danesh. 2012; 18(3): 96-101. [View at Publisher]
22. Ho TP, Zhao X, Courville AB, Linderman JD, Smith S, Sebring N, Della Valle DM, Fitzpatrick B, Simchowitz L, Celi FS. Effects of a 12-month moderate weight loss intervention on insulin sensitivity and inflammation status in nondiabetic overweight and obese subjects.Horm Metab Res. 2015;47(4):289-96. [DOI:10.1055/s-0034-1382011] [PubMed] [Google Scholar]
23. Samjoo IA, Safdar A, Hamadeh MJ, Raha S, Tarnopolsky MA.The effect of endurance exercise on both skeletal muscle and systemic oxidative stress in previously sedentary obese men.Nutr Diabetes. 2013; 3: 88. [View at Publisher] [DOI:10.1038/nutd.2013.30] [PubMed] [Google Scholar]
24. Steckling FM, Farinha JB, Santos DL, Bresciani G, Mortari JA, Stefanello ST, Courtes AA, Duarte T, Duarte MM, Moresco RN, Cardoso MS, Soares FA. High Intensity Interval Training Reduces the Levels of Serum Inflammatory Cytokine on Women with Metabolic Syndrome. Exp Clin Endocrinol Diabetes. 2016; 124(10): 597-601. [View at Publisher] [DOI:10.1055/s-0042-111044] [PubMed] [Google Scholar]
25. Kirwan JP, Del Aguila LF, Hernandez JM, Williamson DL, O'Gorman DJ, Lewis R, et al. Regular exercise enhances insulin activation of IRS-1-associated PI3-kinase in human skeletal muscle. Journal of Applied Physiology. 2000; 88(2): 797-803. [View at Publisher] [DOI:10.1152/jappl.2000.88.2.797] [PubMed] [Google Scholar]
26. Kim Y, Inoue T, Nakajima R, Nakae K, Tamura T, Tokuyama K, et al. Effects of endurance training ofgene expression on insulin signal transduction pathway. Biochemical and Biophysical Research Communications. 1995; 210(3): 766-73. [View at Publisher] [DOI:10.1006/bbrc.1995.1725] [PubMed] [Google Scholar]
27. Carvalho-Filho M, Ropelle E, Pauli R, Cintra D, Tsukumo D, Silveira L, et al. Expression of Concern: Aspirin attenuates insulin resistance in muscle of dietinduced obese rats by inhibiting inducible nitric oxide synthase production and S-nitrosylation of IRβ/IRS-1 and Akt. Diabetologia. 2017:1. [View at Publisher] [DOI:10.1007/s00125-017-4292-5] [PubMed] [Google Scholar]

Add your comments about this article : Your username or Email:
CAPTCHA

Send email to the article author


Rights and permissions
Creative Commons License This work is licensed under a Creative Commons Attribution-NonCommercial 4.0 International License.